dylight 488 vector lab (Vector Laboratories)

Vector Laboratories is a verified supplier

Vector Laboratories manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Vector Laboratories dylight 488 vector lab
Dylight 488 Vector Lab, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/DI-7488-%2E5/DyLight+488+Labeled+Anti-Digoxigenin%2FDigoxin+(DIG)/pm40436014-657-52-54
Average 93 stars, based on 20 article reviews

dylight 488 vector lab - by Bioz Stars, 2026-10

93/100 stars

Images

Incubation:

Article Title: Visualization and quantification of rDNA instabilities in mammalian cells and mouse models
Article Snippet: .. Slides were then incubated with Goat Anti-Digoxigenin/Digoxin (DIG) Antibody and DyLight 488 (Vector Laboratories, Cat. No. DI-7488; 1:200 dilution) at 37°C for 45 min in the dark, washed three times in 4× SSC/0.1% Tween-20, once in 2× SSC, dehydrated again through ethanol series, and mounted with Vectashield containing DAPI (Vector Laboratories, Cat. No. H-1200-100). .. Metaphases were captured and analyzed with a Carl Zeiss AxioImager Z2 equipped with Metafer4 and the ISIS software package (MetaSystems).

Hybridization:

Article Title: Expression pattern changes of three homeologs in chemokine activity enhance antiviral response to herpesvirus infection in a newly synthesized alloheptaploid
Article Snippet: .. Hybridization was performed at 37°C for 16–24 h. Dig-labeled and biotin-labeled genomic DNA probes were detected using anti-digoxin-FITC (Vector, DI-7488-0.5, 1:100) and ExtraAvidin-Cy3 antibody (Sigma-Aldrich, E4142, 1:100), respectively. ..

Article Title: Expression pattern changes of three homeologs in chemokine activity enhance antiviral response to herpesvirus infection in a newly synthesized alloheptaploid.
Article Snippet: .. Hybridization was performed at 37°C for 16–24 h. Dig-labeled and biotin-labeled genomic DNA probes were detected using anti-digoxin-FITC (Vector, DI-7488-0.5, 1:100) and ExtraAvidin-Cy3 antibody (Sigma-Aldrich, E4142, 1:100), respectively. ..

Recombinant:

Article Title: De novo assembly of nuclear stress bodies rearranges and enhances NFIL3 to restrain acute inflammatory responses.
Article Snippet: Article De novo assembly of nuclear stress bodies rearranges and enhances NFIL3 to restrain acute inflammatory responses

Virus:

Control:

Purification:

Staining:

Article Title: Cellular FXIII in Human Macrophage-Derived Foam Cells.
Article Snippet: Non-specific IgG binding was blocked by normal human serum (EMD Millipore Corporation, Burlington, MA, USA) for 15 min. .. Foam cells were stained with rabbit antihuman FXIII-A antibody [29] for 60 min and DyLight 488-labeled goat anti-rabbit antibody (Vector Laboratories, Burlingame, CA, USA) was used as a secondary antibody for 45 min. Then, slides were washed and staining with ORO (Sigma-Aldrich) was performed for 15 min, followed by washing with distilled water three times. .. To counterstain nuclei, Vectashield® mounting medium with DAPI (Vector Laboratories) was used.

other:

Article Title: A multimodal screening platform for endogenous dipeptide repeat proteins in C9orf72 patient iPSC neurons.
Article Snippet: CRISPR/Cas9 tagging of C9orf72 DPRs For tagging of endogenous DPRs with HiBiT, we designed single-guide RNAs (sgRNAs) to induce double-strand breaks 3′ of C9orf72 exon 1b (AGGCGCAGGCGGTGGCGAGT, Synthego).

Review